|
ATCC
293t cells ![]() 293t Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc03572171-170-8-13?v=ATCC Average 99 stars, based on 1 article reviews
293t cells - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
Bio X Cell
anti cd28 ![]() Anti Cd28, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc11590283-446-25-27?v=Bio+X+Cell Average 96 stars, based on 1 article reviews
anti cd28 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Qiagen
rneasy microarray tissue mini kit ![]() Rneasy Microarray Tissue Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc04720531-58-20-25?v=Qiagen Average 99 stars, based on 1 article reviews
rneasy microarray tissue mini kit - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
R&D Systems
antibodies against thbs4 ![]() Antibodies Against Thbs4, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pm17182969-48-65-71?v=R%26D+Systems Average 94 stars, based on 1 article reviews
antibodies against thbs4 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
ATCC
human lung carcinoma cell line a549 ![]() Human Lung Carcinoma Cell Line A549, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc03162545-94-1-31?v=ATCC Average 99 stars, based on 1 article reviews
human lung carcinoma cell line a549 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
ATCC
monkey vero e6 ![]() Monkey Vero E6, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc07292764-156-0-3?v=ATCC Average 99 stars, based on 1 article reviews
monkey vero e6 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
Promega
moloney monkey leukemia virus reverse transcriptase ![]() Moloney Monkey Leukemia Virus Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc03077941-96-31-37?v=Promega Average 90 stars, based on 1 article reviews
moloney monkey leukemia virus reverse transcriptase - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Promega
random primer promega ![]() Random Primer Promega, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc03077941-96-26-27?v=Promega Average 90 stars, based on 1 article reviews
random primer promega - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Proteintech
rhau ![]() Rhau, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pm26489465-159-7-12?v=Proteintech Average 93 stars, based on 1 article reviews
rhau - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Kemper GmbH
egme ![]() Egme, supplied by Kemper GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc09933818-16-12-56?v=Kemper+GmbH Average 90 stars, based on 1 article reviews
egme - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Aviva Systems
anti pogr or51e1 ![]() Anti Pogr Or51e1, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pm18953328-81-29-32?v=Aviva+Systems Average 90 stars, based on 1 article reviews
anti pogr or51e1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Becton Dickinson
anti-cd20-apc ![]() Anti Cd20 Apc, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Monkey+PCR+Microarrays/pmc06869333-171-22-23?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
anti-cd20-apc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS ONE
Article Title: Cellular MicroRNAs 498 and 320d Regulate Herpes Simplex Virus 1 Induction of Kaposi’s Sarcoma-Associated Herpesvirus Lytic Replication by Targeting RTA
doi: 10.1371/journal.pone.0055832
Figure Lengend Snippet: ( A ) . Luciferase reporter assay for screening miRNAs that target KSHV RTA 3′UTR. 293T cells were co-transfected with negative control nucleotide of miRNA ( Neg. Ctrl. ) or mimics of several miRNAs together with the pGL3-Luc-RTA 3′UTR luciferase reporter and assayed for luciferase activity. ** P <0.01 and *** P <0.001 for Student’s t-test versus Neg. Ctrl. group. ( B ) . Both miR-498 and miR-320d only inhibited the reporter activity of pGL3-RTA 3′UTR but not that of pGL3-Control construct. Luciferase activity was detected by co-transfection pGL3-Control or pGL3-RTA 3′UTR construct along with Neg. Ctrl., mimic of miR-498 ( miR-498 ) or miR-320d ( miR-320d ) for 24 h in 293T cells. The relative reporter activity levels of pGL3-RTA 3′UTR and pGL3-Control in the Neg. Ctrl. group were considered to be “1” for comparison, respectively. ** P <0.01 for Student’s t-test versus pGL3-RTA 3′UTR plus Neg. Ctrl. group . ( C ) . RT-qPCR analysis for validating the miRNA microarray data. MiR-498 and miR-320d expression in BCBL-1 cells infected with HSV-1 or Mock for 24 h was quantitated by RT-qPCR. Relative quantities of miRNAs expression were represented as 2 −ΔΔCt on the y axis. ** P <0.01 and *** P <0.001 for Student’s t-test versus Mock group. ( D ) . Inhibition of RTA protein expression by miR-498 and miR-320d. A genomic RTA expression vector pcDNA3.1−3×Flag-RTA-3′UTR bearing the full 3′UTR sequences was co-transfected with pEGFP and mimic of miR-498 or miR-320d into 293T cells for 48 h. Cells were collected and immunoblotted with the indicated antibodies. The relative level of RTA was determined by quantitative densitometry. Numbers labeled above the RTA band were the relative intensities of the bands compared to EGFP. The relative level of RTA in the Neg. Ctrl.+pcDNA3.1−3×Flag-RTA-3′UTR+pEGFP-N2 group was considered to be 1 for comparison. ( E ) . Schematic illustration of the putative seed sequences of miR-320d ( S1 ) and miR-498 ( S2 ) within the 3′UTR of RTA, and mutagenesis of target sites in the RTA 3′UTR or miRNA mimics. Mutated nucleotides in the target sites were framed in red. ( F ) . Effect of mutagenesis on miR-498 or miR-320d targeting of the 3′UTR of RTA. After co-transfection of RTA wild type ( RTA WT ) or mutant 3′UTR construct ( mut S1 or mut S2 ) together with natural (miR-498 or miR-320d) or mutant miR-498 or miR-320d mimic (mut miR-498 or mut miR-320d) for 24 h, 293T cells were assayed for luciferase activity. *** P <0.001 for Student’s t-test versus Neg.Ctrl.+RTA WT.
Article Snippet: Vero cells (African green monkey kidney fibroblasts) and
Techniques: Luciferase, Reporter Assay, Transfection, Negative Control, Activity Assay, Control, Construct, Cotransfection, Comparison, Quantitative RT-PCR, Microarray, Expressing, Infection, Inhibition, Plasmid Preparation, Labeling, Mutagenesis
Journal: Immunity
Article Title: CRISPR screens unveil nutrient-dependent lysosomal and mitochondrial nodes impacting intestinal tissue-resident memory CD8 + T cell formation
doi: 10.1016/j.immuni.2024.09.013
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Purified naive OT-I, P14, or YopE-I cells were activated for 20 h with 5 μg/ml plate-bound anti-CD3 (2C11, Bio X Cell) and 5 μg/ml plate-bound
Techniques: Purification, Virus, Expressing, Mutagenesis, Recombinant, Electron Microscopy, Control, Modification, Plasmid Preparation, Cell Isolation, Transfection, Sample Prep, Reverse Transcription, SYBR Green Assay, Microarray, RNA Sequencing Assay, Knock-In, Sequencing, Software, Flow Cytometry, Microscopy, Real-time Polymerase Chain Reaction
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 1. THBS4 and THBS2 expression levels in human (Hs) and chimpanzee brain (Pt) from oligonucleotide microarrays. Graphs show the average hybridization signal intensity and standard error in different brain regions of each species. The brain regions are FCx, frontal cortex (FP, middle frontal gyrus, and Brodmann area 9); TCx, temporal cortex (Broca’s area, TP, aIT cortex, and superior temporal gyrus); VCx, primary visual cortex; ACCx, anterior cingulate cortex; Cau, caudate nucleus; Cb, cerebellar vermis. The number of individuals analyzed was 9 humans and 5 chimpanzees for FCx, 6 humans and 6 chimpanzees for TCx, and 3 humans and 3 chimpanzees for the other brain regions. The average hybridization signal resulting from combining together all the forebrain regions (FCx, TCx, VCx, ACCx, and Cau) is represented by dashed and dotted lines in humans and chimpanzees, respectively. Asterisks indicate the results of the Mann--Whitney test for the comparison of THBS4 and THBS2 levels for each region between humans and chimpanzees. *P \ 0.05; **P \ 0.01.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: Expressing, Hybridization, MANN-WHITNEY, Comparison
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 3. THBS4 and THBS2 expression levels in nonbrain tissues from humans and nonhuman primates. (A) Oligonucleotide microarray results for THBS4 and THBS2 in nonbrain tissues of humans and chimpanzees. Graphs show the average hybridization signal in different tissues of 6 humans (Hs) and 5 chimpanzees (Pt), including brain frontal cortex for comparison. (B) Real-time RT-PCR quantification of THBS4 and THBS2 expression levels in heart from different primate species. The average number of copies of thrombospondin (THBS) mRNA for 1000 b-actin (ACTB) mRNA copies in humans, chimpanzees, and rhesus macaques is represented on the y axis. Error bars represent standard errors. The results of the Mann--Whitney test comparing THBS4 and THBS2 expression levels between humans and nonhuman primates are represented by asterisks. *P \ 0.05; **P \ 0.01.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: Expressing, Microarray, Hybridization, Comparison, Quantitative RT-PCR, MANN-WHITNEY
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 4. Quantification of THBS4 and THBS2 protein levels in primate frontal cortex by Western blot analysis. (A) Western blot results for THBS4 (103.5 kDa), THBS2 (129.0 kDa), and b-tubulin (TUBB) (49.8 kDa) using FP samples of 3 humans (Hs), 3 chimpanzees (Pt), and 3 rhesus macaques (Mm). For each protein, one representative blot is shown on top and the average band intensity from the 3 different blots quantified is shown below. In each blot, band intensities were normalized to those of one human case (Hs2). (B) Average THBS4 and THBS2 protein levels in the FP of humans, chimpanzees, and rhesus macaques. The y axis corresponds to the average band intensities of the 3 individuals of each species relative to the human value, after normalization by TUBB levels to control for protein loading differences. Error bars represent standard errors. Asterisks indicate the results of the Mann--Whitney test for the comparison of thrombospondin levels between humans and nonhuman primates. *P \ 0.05.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: Western Blot, Control, MANN-WHITNEY, Comparison
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 5. Histological localization of THBS4 mRNA in primate frontal cortex by in situ hybridization. (A--C) Low-magnification photomicrographs of the frontal polar cortex of a human (A), a chimpanzee (B), and a rhesus macaque (C), showing the hybridization of the THBS4 antisense probe in unfixed, snap-frozen sections. (D--E) High- magnification photomicrographs of fixed tissue sections showing numerous pyramidal cells labeled for THBS4 mRNA in cortical layer 3 of a human (D) and a chimpanzee (E). Scale bars: (A--C) 250 lm; (D--E) 50 lm.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: In Situ Hybridization, Hybridization, Labeling
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 6. THBS4 mRNA expression in various cell types of human frontal cortex. (A-- B) Gray and white matter sections double labeled by in situ hybridization for THBS4 mRNA (blue staining) and by immunocytochemistry for the astrocyte-specific marker GFAP (brown staining). (A) In gray matter, arrowheads denote THBS4-expressing astrocytes in layer 1 and in deeper layers of the cortex. Not all GFAP-immunoreactive cells were clearly labeled with the THBS4 antisense probe, however. The cells in layers 2 and 3 exhibiting blue label only were probably neurons. (B) In the white matter (WM), a large population of small cells labeled strongly for THBS4 mRNA but did not stain for GFAP (arrowheads). Based on their number and size, these were probably oligodendrocytes. (C) Endothelial cells in the wall of a cerebral blood vessel labeled by in situ hybridization for THBS4 mRNA are indicated by arrowheads. The red coloration of the vessel is from blood. Scale bars: (A--B) 50 lm; (C) 10 lm.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: Expressing, Labeling, In Situ Hybridization, Staining, Immunocytochemistry, Marker
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 7. Localization of THBS4 protein by immunohistochemistry in the frontal polar cortex of humans, chimpanzees, and macaques. (A--C) High-magnification photo- micrographs with differential-interference contrast optics of 5-lm-thick, paraffin- embedded sections through the upper part of cortical layer 3 of a human (A), a chimpanzee (B), and a rhesus macaque (C). (D--F) Representative low-magnification photomicrographs from 50-lm-thick fixed sections through cortical layers 1--6 of a human (D), a chimpanzee (E), and a rhesus macaque (F). In all species, THBS4 antibodies labeled numerous cell bodies, including many pyramidal cells in layers 2--6. Humans, however, were distinguished by dense labeling of the neuropil surrounding cell bodies. Scale bars: (A--C) 50 lm; (D--F) 250 lm.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: Immunohistochemistry, Labeling
Journal: Cerebral cortex (New York, N.Y. : 1991)
Article Title: Increased cortical expression of two synaptogenic thrombospondins in human brain evolution.
doi: 10.1093/cercor/bhl140
Figure Lengend Snippet: Figure 8. THBS4 immunostaining of Ab-containing plaques in gray matter from human cortex. (A) Section of frontal cortex from an Alzheimer’s case labeled with anti- THBS4 antibody and DAB (red-brown staining), revealing numerous plaque-like accumulations in the upper cortical layers, several of which are denoted by arrowheads. (B) A neighboring section stained for Ab peptide with 4G8 antibody and Vector Nickel (dark staining), revealing numerous well-defined Ab-containing plaques. (C) Higher-magnification photomicrograph of a section from the same case double-labeled for THBS4 with DAB (red-brown staining) and for Ab protein with Vector Nickel (dark staining). The sequential double-staining protocol yielded a mosaic of small red-brown and dark purple territories within the plaques. Scale bars: (A--B) 100 lm; (C) 50 lm.
Article Snippet: Blots were blocked in 10% horse serum (for goat antibodies) or 5% nonfat powdered milk (for mouse and rabbit antibodies) and incubated with the primary antibody overnight at 4 C. We used 2 different antibodies against THBS2, one monoclonal (Cat. no. 611150, BD Transduction Laboratories, San Jose, CA, 1:200 dilution) and one polyclonal (Cat. no. AF1635, R&D Systems, Minneapolis, MN 1:200 dilution), and 3 polyclonal
Techniques: Immunostaining, Labeling, Staining, Plasmid Preparation, Double Staining
Journal: Virology Journal
Article Title: Lysosome-associated membrane glycoprotein 3 is involved in influenza A virus replication in human lung epithelial (A549) cells
doi: 10.1186/1743-422X-8-384
Figure Lengend Snippet: LAMP3 is specifically induced upon influenza A virus infection . (A) Microarray results for LAMP1, LAMP2, and LAMP3 expression at different time points post influenza virus infection. A549 cells were infected with A/PR/8/34 virus at a MOI of 0.5. At indicated time points post-infection (p.i.), total cellular RNA was extracted and subjected to microarray analysis. (B) RT-PCR analysis for LAMP1, LAMP2, and LAMP3 expression. A549 cells were infected with A/PR/8/34 virus. After 12 h, 18, or 24 h, total cellular RNA was extracted and subjected to RT-PCR with specific primers. GAPDH gene was used as an internal control. (C) Western blot analysis for LAMP3 expression. A549 or Vero cells were treated as indicated in (B) and were lysed with RIPA buffer. Cell lysates were subjected to Western blot analysis with antibodies against LAMP3. β-actin was used as a loading control.
Article Snippet: The
Techniques: Virus, Infection, Microarray, Expressing, Reverse Transcription Polymerase Chain Reaction, Control, Western Blot
Journal: Virology Journal
Article Title: Lysosome-associated membrane glycoprotein 3 is involved in influenza A virus replication in human lung epithelial (A549) cells
doi: 10.1186/1743-422X-8-384
Figure Lengend Snippet: Knockdown of LAMP3 inhibits influenza A virus replication . (A) Knockdown of LAMP1 or LAMP3 by RNAi. A549 cells were transfected with the siRNA against LAMP1, LAMP3 or a non-targeting control RNA (scrambled) (50 nM). Seventy two hours later, cells were lysed and subjected to Western blot analysis using antibody against LAMP1 or LAMP3. (B) In-cell western assay for NP production. A549 cells grown in 96-well plates were transfected siRNAs as indicated in (A). After 72 h, cells were either infected or mock infected by influenza virus, and were subjected to in-cell western assay at 24 h p.i.. NP was visualized via labeling with NP specific antibody, and endogenous lamin A was labeled as a control. (C) Quantitative analysis of in-cell western using Odyssey Imaging System. * Student's t test, p = 0.031.(D) A549 cells were transfected with LAMP3, LAMP1 or control siRNAs, cells were then infected with A/PR/8/34 virus at a MOI of 0.1 at 72 h post-transfection. Cell supernatants were harvested and subjected to TCID 50 assay 24 h p. i.(E) A549 cells were left untransfected, or were transfected with an IFN-β reporter plasmid, along with the scrambled siRNA, siRNA against LAMP3 (SiLAMP3), or poly (I:C) at 50 ng/ml (a positive control for IFN promoter activation), and analyzed 48 h later for luciferase assay.
Article Snippet: The
Techniques: Knockdown, Virus, Transfection, Control, Western Blot, In-Cell ELISA, Infection, Labeling, Imaging, Plasmid Preparation, Positive Control, Activation Assay, Luciferase
Journal: Virology Journal
Article Title: Lysosome-associated membrane glycoprotein 3 is involved in influenza A virus replication in human lung epithelial (A549) cells
doi: 10.1186/1743-422X-8-384
Figure Lengend Snippet: LAMP3 regulates post-entry steps of influenza A virus replication . (A) NP localization during influenza A virus replication. A549 cells were transfected with a LAMP3 specific siRNA or a control siRNA (Scrambled), and then infected with A/PR/8/34 virus at a MOI of 10 or 0.1. Cells were fixed at indicated time points respectively, and then subjected to indirect immunofluorescence assays for NP localization. (B) Quantitative analysis for ratios of NP nuclear imported cells/total infected cells. Analyses were carried out for cells infected with A/PR/8/34 virus at a MOI of 10 for 4 h. * Student's t test, p = 0.016.
Article Snippet: The
Techniques: Virus, Transfection, Control, Infection, Immunofluorescence
Journal: Cell host & microbe
Article Title: NON-NEUTRALIZING ANTIBODIES FROM A MARBURG INFECTION SURVIVOR MEDIATE PROTECTION BY FC-EFFECTOR FUNCTIONS AND ENHANCING EFFICACY OF OTHER ANTIBODIES
doi: 10.1016/j.chom.2020.03.025
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Recombinant, Virus, Clinical Proteomics, Infection, Staining, Expressing, Saline, Sequencing, Plasmid Preparation, Mutagenesis, Ligation, One Step RT-PCR, Peptide Microarray, Software, Flow Cytometry, High Throughput Screening Assay, Cytometry, Chromatography, Microscopy, Magnetic Beads
Journal: Cell reports
Article Title: Post-transcriptional Regulation of Nkx2-5 by RHAU in Heart Development.
doi: 10.1016/j.celrep.2015.09.043
Figure Lengend Snippet: Figure 1. Deletion of Rhau in the Cardiac Mesoderm and Progenitors Caused Severe Heart Defects (A) Detection of RHAU protein levels in heart tissue during the embryonic stage and after birth. GAPDH was used as a control. (B) Western blotting to show deletion efficiency of Rhau in embryonic heart tissue at E11.5. Actin protein levels are shown for equal loading control. (C) Gross and histological analysis of mouse em- bryos and their hearts. The heart of Rhau-deletion mice manifested poorly developed myocardium and ventricular septum. Scale bars, 1mm for mouse embryos, 50 mm for histology. (D) Gross analysis of mouse embryos. Rhau-dele- tion mice displayed widespread hemorrhage at E14.5. Scale bars, 2.5 mm. (E) Histological analysis of hearts. Myocardial development of Rhau-deletion mice was impaired. Scale bars, 50 mm. (F) Western blotting to show the deletion efficiency of Rhau in embryonic heart tissue (E11.5).
Article Snippet: Antibodies against Nkx2-5(13921-1-AP, for western blotting) and
Techniques: Control, Western Blot
Journal: Cell reports
Article Title: Post-transcriptional Regulation of Nkx2-5 by RHAU in Heart Development.
doi: 10.1016/j.celrep.2015.09.043
Figure Lengend Snippet: Figure 3. Rhau Deletion Increased Nkx2-5 mRNA Levels in the Heart (A) Heatmap of microarray analysis. (B) Gene Ontology analysis. (C) Real-time RT-PCR measurement of Nkx2-5 expression levels in E9.5 heart tissues. (D) Real-time RT-PCR measurement of expression levels of essential cardiac transcription factors. (E) Northern blotting analysis of Nkx2-5 mRNA levels in embryonic heart tissues. (F) Whole-embryo in situ hybridization (WISH) dis- playing Nkx2-5 mRNA distribution and levels in the embryonic heart. Scale bars, 50 mm. Data represent means ± SD from at least three independent experiments.
Article Snippet: Antibodies against Nkx2-5(13921-1-AP, for western blotting) and
Techniques: Microarray, Quantitative RT-PCR, Expressing, Northern Blot, In Situ Hybridization
Journal: Cell reports
Article Title: Post-transcriptional Regulation of Nkx2-5 by RHAU in Heart Development.
doi: 10.1016/j.celrep.2015.09.043
Figure Lengend Snippet: Figure 4. Protein Levels of Nkx2-5 Were Reduced in Rhau-Deletion Heart and Cardi- omyocytes (A and B) Western blotting analysis. (C and D) Real-time RT-PCR analysis. (E) IF staining. Data represent means ± SD from at least three independent experiments. Scale bars, 10 mm.
Article Snippet: Antibodies against Nkx2-5(13921-1-AP, for western blotting) and
Techniques: Western Blot, Quantitative RT-PCR, Staining
Journal: Cell reports
Article Title: Post-transcriptional Regulation of Nkx2-5 by RHAU in Heart Development.
doi: 10.1016/j.celrep.2015.09.043
Figure Lengend Snippet: Figure 5. Association of HuR and RHAU with Nkx2-5 mRNA (A) Real-time RT-PCR analysis after blocking mRNA synthesis. (B) Study of pre-mRNA splicing of Nkx2-5. (C) Analysis of Nkx2-5 mRNA transportation. (D) RNA IP assays were performed by using anti-HuR, anti-RHAU, or anti-IgG antibody with H9C2 cell lysates. The presence of Nkx2-5 mRNA was determined by RT-PCR. (E and F) RNA pull-down assays by using in-vitro-transcribed and biotinylated Nkx2-5 50 UTR, CR, and 30 UTR (E) or in-vitro-transcribed and biotinylated 30 UTR 3-1, 30 UTR 3-2, and 30 UTR 3-3 (containing the ARE) (F). (G) Conservation of the AREs (red) in the Nkx2-5 30 UTR. (H) RNA pull-down assays were performed to assess the association of HuR with Nkx2-5 50 UTR, CR, and 30 UTR, as described in (E). (I) RNA pull-down assays were performed to assess the association of HuR with the Nkx2-5 30 UTR, 30 UTR 3-1, 30 UTR 3-2, 30 UTR 3-3 (containing the ARE), and 30
Article Snippet: Antibodies against Nkx2-5(13921-1-AP, for western blotting) and
Techniques: Quantitative RT-PCR, Blocking Assay, Reverse Transcription Polymerase Chain Reaction, In Vitro
Journal: Cell reports
Article Title: Post-transcriptional Regulation of Nkx2-5 by RHAU in Heart Development.
doi: 10.1016/j.celrep.2015.09.043
Figure Lengend Snippet: Figure 6. Influence of HuR and RHAU on the Half-Life of Nkx2-5 mRNA (A) H9C2 cells were transfected with a vector expressing HuR or with HuR siRNA (siHuR). Afterward, cell lysates were prepared and subjected to western blotting analysis to assess protein levels of HuR, Nkx2-5, and GAPDH. (B) H9C2 cells were transfected with a vector expressing RHAU or with Rhau siRNA (siRhau). Later on, cell lysates were prepared and subjected to western blotting analysis to assess protein levels of RHAU, Nkx2-5, and GAPDH. (C and D) RNA prepared from cells described in (A) and (B) was subjected to real-time qPCR to assess mRNA levels of Nkx2-5. (E and F) Cells described in (A) and (B) were treated with actinomycin D (2 mg/ml). RNA was prepared at distinct time points and subjected to real-time qPCR to assess the half-lives of Nkx2-5 and actin mRNAs. Data represent the means ± SD from three independent experiments.
Article Snippet: Antibodies against Nkx2-5(13921-1-AP, for western blotting) and
Techniques: Transfection, Plasmid Preparation, Expressing, Western Blot
Journal: Cell reports
Article Title: Post-transcriptional Regulation of Nkx2-5 by RHAU in Heart Development.
doi: 10.1016/j.celrep.2015.09.043
Figure Lengend Snippet: Figure 7. RHAU Controlled Nkx2-5 mRNA Translation by Resolving the G-Quadruplex in the 50 UTR (A) Inhibition of the proteasomal and lyso- somal degradation pathway and western blotting analysis. (B) RNA pull-down analysis to investigate RHAU association with Nkx2-5 mRNA 50 UTR fragments. 50 UTR 5-2 contains G-quadruplex sequence as depicted in (C). (C) Comparison of the G-quadruplex sequences in the 50 UTR of Nkx2-5 mRNA from different species. (D and E) Western blotting analysis. The 50 UTR of Nkx2-5 mRNA were cloned upstream of GFP CR in the eukaryotic GFP expression vector. Afterward, both GFP expression vector and GFP expression vector-bearing 50 UTR of Nkx2-5 mRNA were used for cell transfection, followed by western blotting analysis (D). (E) 6Gs in the G-quadruplex se- quences in the 50 UTR of Nkx2-5 mRNA were mutated to A. The mutated fragment was cloned upstream of Nkx2-5 mRNA CR. After cell trans- fection, Nkx2-5 protein levels were assessed by western blotting analysis. (F) Co-transfection of RHAU with GFP expression vector-bearing the 50 UTR of Nkx2-5 mRNA enhanced GFP protein levels.
Article Snippet: Antibodies against Nkx2-5(13921-1-AP, for western blotting) and
Techniques: Inhibition, Western Blot, Sequencing, Comparison, Clone Assay, Expressing, Plasmid Preparation, Transfection, Cotransfection
Journal: Archives of Toxicology
Article Title: Circulating microRNAs as promising testicular translatable safety biomarkers: current state and future perspectives
doi: 10.1007/s00204-023-03460-0
Figure Lengend Snippet: Summary of testis toxicants and mechanism of action
Article Snippet: miR-34b/c, miR449a , Monkey , hsa-miR-34b-3p: CAAUCACUAACUCCACUGCCAU hsa-miR-34c-3p: AAUCACUAACCACACGGCCAGG hsa-miR-449a: UGGCAGUGUAUUGUUAGCUGGU ,
Techniques: Disruption
Journal: Archives of Toxicology
Article Title: Circulating microRNAs as promising testicular translatable safety biomarkers: current state and future perspectives
doi: 10.1007/s00204-023-03460-0
Figure Lengend Snippet: Summary of circulating miRNAs as potential non-invasive biomarkers for drug-induced testicular injury
Article Snippet: miR-34b/c, miR449a , Monkey , hsa-miR-34b-3p: CAAUCACUAACUCCACUGCCAU hsa-miR-34c-3p: AAUCACUAACCACACGGCCAGG hsa-miR-449a: UGGCAGUGUAUUGUUAGCUGGU ,
Techniques: Clinical Proteomics, Cell Differentiation, Microarray
Journal: Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc
Article Title: Novel markers for enterochromaffin cells and gastrointestinal neuroendocrine carcinomas.
doi: 10.1038/modpathol.2008.174
Figure Lengend Snippet: Figure 2 Quantitative real-time-PCR on normal ileal mucosa, primary tumor, liver and mesentery metastases specimens confirms microarray gene expression data. Total RNAwas isolated from frozen tissue: 13 normal ileal mucosa (N), 15 primary tumors (P) and 17 metastases (Met) (8 mesentery and 9 liver). The metastases were obtained from treated (red) and untreated (black) patients. cDNA was synthesized and Q-RT-PCR was performed for GRIA2, PTPRN, SCG3, SPOCK1, PNMA2, SERPINA10 (a); CXCL14, NKX2-3 (b); GPR112, OR51E1 (c). Ct values were calculated and the data were evaluated using the 2DDCt method using b-actin from each individual sample for normalization. Average values from triplicate samples with standard deviations are shown.
Article Snippet: Primary rabbit antibodies were diluted in Antibody diluentss (Lab Vision) as follows, anti-SCG3 1:250, anti-PNMA2 1:350, anti-GRIA2 1:20 (Atlas Antibodies, Stockholm, Sweden), anti-GluR-2 (GRIA2) 1:40 (Epitomics, Burlingame, CA, USA),
Techniques: Real-time Polymerase Chain Reaction, Microarray, Gene Expression, Isolation, Synthesized, Reverse Transcription Polymerase Chain Reaction
Journal: Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc
Article Title: Novel markers for enterochromaffin cells and gastrointestinal neuroendocrine carcinomas.
doi: 10.1038/modpathol.2008.174
Figure Lengend Snippet: Figure 4 Immunohistochemical staining of normal ileum, primary tumor and corresponding metastasis. Secretogranin-3 (SCG3) is highly expressed exclusively in the cytoplasm of endocrine cells in normal ileum, primary tumor (six of six cases) and corresponding metastasis (six of six cases), thus verifying the carcinoid diagnosis. Paraneo-plastic antigen Ma2 (PNMA2) is weakly expressed in glandular cells but moderately expressed in primary tumor (six of six cases) and corresponding metastasis (six of six cases). Glutamate receptor 2 (GRIA2) is not expressed in neither normal nor tumor compartments. Olfactory receptor 51E1 (OR51E1) shows membranous staining in normal glandular cells and lymphoid cells but not in tumor compartments.
Article Snippet: Primary rabbit antibodies were diluted in Antibody diluentss (Lab Vision) as follows, anti-SCG3 1:250, anti-PNMA2 1:350, anti-GRIA2 1:20 (Atlas Antibodies, Stockholm, Sweden), anti-GluR-2 (GRIA2) 1:40 (Epitomics, Burlingame, CA, USA),
Techniques: Immunohistochemical staining, Staining, Biomarker Discovery
Journal: Journal of leukocyte biology
Article Title: Monocyte subsets exhibit transcriptional plasticity and a shared response to interferon in SIV-infected rhesus macaques
doi: 10.1002/JLB.4A0217-047R
Figure Lengend Snippet: (A) Classical, intermediate, and nonclassical monocytes were isolated from total PBMCs from each animal at each infection time point. Monocytes were selected based on high forward scatter and intermediate side scatter. HLA-DR+ cells were positively selected and CD3+ T-cells and CD20+ B-cells were excluded. Nonoverlapping populations of classical (CD14++CD16−, red gate), intermediate (CD14++CD16+, blue gate), and nonclassical (CD14+CD16++, green gate) monocytes were sorted based on expression of CD14 and CD16. (B) Paired XY values for gene expression values determined by microarray and qRT-PCR. For qRT-PCR analysis, cDNA was made from the same RNA used in the microarray analysis. Nine samples had sufficient RNA remaining to validate four targets each. GAPDH was used as a housekeeping gene. Gene expression values determined by qRT-PCR significantly correlated with the gene expression values determined by microarray (Spearman r = 0.56, P = 0.0003). (C) The number of gene expression comparisons with ≥2.0 AFC between monocyte subsets prior to infection, at 26 dpi, and at necropsy. The length of the line between monocyte subsets is proportional to the number of differentially expressed genes. Intermediate monocytes are most similar to classical monocytes, but increase in similarity to nonclassical monocytes terminally with AIDS
Article Snippet: Buffy coats were collected and washed in calcium- and magnesium-free PBS and stained for 15 min with anti-CD14-PacificBlue, anti-CD16-PE, anti-HLA-DR-PerCP-Cy-5.5, anti-CD3-FITC, and
Techniques: Isolation, Infection, Expressing, Microarray, Quantitative RT-PCR